Applications/Libbeagle - Revision history

Pysdlb: /* Further Information */

2022-11-16T11:06:23Z

‎Further Information

Pysdlb at 13:59, 13 October 2022

2022-10-13T13:59:57Z

Pysdlb at 09:03, 5 April 2017

2017-04-05T09:03:41Z

Pysdlb at 09:03, 5 April 2017

2017-04-05T09:03:05Z

Pysdlb at 09:01, 5 April 2017

2017-04-05T09:01:33Z

Pysdlb: Pysdlb moved page Libbeagle to Applications/Libbeagle without leaving a redirect

2017-04-05T08:48:39Z

Pysdlb moved page Libbeagle to Applications/Libbeagle without leaving a redirect

Pysdlb: Created page with "TOC ==Application Details== *Description: BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood..."

2017-04-05T08:47:46Z

Created page with "__TOC__ ==Application Details== *Description: BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood..."

New page

__TOC__
==Application Details==
*Description: BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood phylogenetics packages.
*Version: 2.1.2
*Module: libbeagle/2.1.2
*Licence: Free/Github Open source

==Usage Examples==

BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood phylogenetics packages. It can make use of highly-parallel processors such as those in graphics cards (GPUs) found in many PCs.

The project involves an open API and fast implementations of a library for evaluating phylogenetic likelihoods (continuous time Markov processes) of biomolecular sequence evolution.

The aim is to provide high performance evaluation 'services' to a wide range of phylogenetic software, both Bayesian samplers and Maximum Likelihood optimizers. This allows these packages to make use of implementations that make use of optimized hardware such as graphics processing units.

===Module===
<pre style="background-color: #000000; color: white; border: 2px solid black; font-family: monospace, sans-serif;">
[username@login01 ~]$ module add libbeagle/2.1.2
</pre>

===Examples===

A C code snippet is shown below using the beagle library:

<pre style="background-color: #f5f5dc; color: black; font-family: monospace, sans-serif;">

#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include <iostream>
#include "beagle.h"

char *human = (char*)"AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTACTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAAGAAATTTAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTG-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCGGAGCTTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCT-AAATCCTATATATCTTA-CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGA";
char *chimp = (char*)"AGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATAATAGGAGTTCAAATCCCCTTATTTCTACTAGGACTATAAGAATCGAACTCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTACACCCTTCCCGTACTAAGAAATTTAGGTTAAGCACAGACCAAGAGCCTTCAAAGCCCTCAGCAAGTTA-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATTAATGGGACTTAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCAGAGCTTGGTAAAAAGAGGCTTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCTAAAGCTGGTTTCAAGCCAACCCCATGACCTCCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAAGTTAAATTACAGGTT-AACCCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCATTAACCTTTTAAGTTAAAGATTAAGAGGACCGACACCTCTTTACAGTGA";
char *gorilla = (char*)"AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGAGGTTTAAACCCCCTTATTTCTACTAGGACTATGAGAATTGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTGTCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTCACATCCTTCCCGTACTAAGAAATTTAGGTTAAACATAGACCAAGAGCCTTCAAAGCCCTTAGTAAGTTA-CAACACTTAATTTCTGTAAGGACTGCAAAACCCTACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATCAATGGGACTCAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAGTCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAT-TCACCTCGGAGCTTGGTAAAAAGAGGCCCAGCCTCTGTCTTTAGATTTACAGTCCAATGCCTTA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGACCTTCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAGGTTAAATTACGGGTT-AAACCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCGTTAACCTTTTAAGTTAAAGATTAAGAGTATCGGCACCTCTTTGCAGTGA";

</pre>

==Further Information==

[https://github.com/beagle-dev/beagle-lib https://github.com/beagle-dev/beagle-lib]

{|
|style="width:5%; border-width: 0" | [[File:icon_home.png]]
|style="width:95%; border-width: 0" |
* [[Main_Page|Home]]
* [[Applications|Application support]]
* [[General|General]]
* [[Training|Training]]
* [[Programming|Programming support]]

|-
|}

@@ Line 50: / Line 50: @@
 ==Further Information==
-[https://github.com/beagle-dev/beagle-lib https://github.com/beagle-dev/beagle-lib]
+*[https://github.com/beagle-dev/beagle-lib https://github.com/beagle-dev/beagle-lib]
-{|
+{{Librariespagenav}}

@@ Line 12: / Line 12: @@
 The project involves an open API and fast implementations of a library for evaluating phylogenetic likelihoods (continuous time Markov processes) of biomolecular sequence evolution.
-The aim is to provide high performance evaluation 'services' to a wide range of phylogenetic software, both Bayesian samplers and Maximum Likelihood optimizers. This allows these packages to make use of implementations that make use of optimized hardware such as graphics processing units.
+The aim is to provide high-performance evaluation 'services' to a wide range of phylogenetic software, both Bayesian samplers and Maximum Likelihood optimizers. This allows these packages to make use of implementations that make use of optimized hardware such as graphics processing units.
 The following software packages can make use of the BEAGLE library:

@@ Line 16: / Line 16: @@
 The following software packages can make use of the BEAGLE library:
-* BEAST [http://beast.bio.ed.ac.uk/]
+* BEAST [http://beast.bio.ed.ac.uk/ http://beast.bio.ed.ac.uk/]
-* Garli [https://garli.googlecode.com/]
+* Garli [https://garli.googlecode.com/ https://garli.googlecode.com/]
-* MrBayes [http://mrbayes.sourceforge.net/]
+* MrBayes [http://mrbayes.sourceforge.net/ http://mrbayes.sourceforge.net/]
-* PhyML [https://phyml.googlecode.com/]
+* PhyML [https://phyml.googlecode.com/ https://phyml.googlecode.com/]

← Older revision		Revision as of 09:01, 5 April 2017
Line 13:		Line 13:

	The aim is to provide high performance evaluation 'services' to a wide range of phylogenetic software, both Bayesian samplers and Maximum Likelihood optimizers. This allows these packages to make use of implementations that make use of optimized hardware such as graphics processing units.		The aim is to provide high performance evaluation 'services' to a wide range of phylogenetic software, both Bayesian samplers and Maximum Likelihood optimizers. This allows these packages to make use of implementations that make use of optimized hardware such as graphics processing units.
		+
		+	The following software packages can make use of the BEAGLE library:
		+
		+	* BEAST [http://beast.bio.ed.ac.uk/]
		+	* Garli [https://garli.googlecode.com/]
		+	* MrBayes [http://mrbayes.sourceforge.net/]
		+	* PhyML [https://phyml.googlecode.com/]
		+

	===Module===		===Module===

@@ Line 29: / Line 29: @@
 ===Examples===
-A C code snippet is shown below using the beagle library:
+A '''C''' code snippet is shown below using the beagle library:
 <pre style="background-color: #f5f5dc; color: black; font-family: monospace, sans-serif;">

← Older revision	Revision as of 08:48, 5 April 2017
(No difference)

Applications/Libbeagle - Revision history

Pysdlb: /* Further Information */

Pysdlb at 13:59, 13 October 2022

Pysdlb at 09:03, 5 April 2017

Pysdlb at 09:03, 5 April 2017

Pysdlb at 09:01, 5 April 2017

Pysdlb: Pysdlb moved page Libbeagle to Applications/Libbeagle without leaving a redirect

Pysdlb: Created page with "__TOC__ ==Application Details== *Description: BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood..."

Pysdlb: Created page with "TOC ==Application Details== *Description: BEAGLE is a high-performance library that can perform the core calculations at the heart of most Bayesian and Maximum Likelihood..."